ATP5MF (NM_001003713) Human 3' UTR Clone

CAT#: SC201946

3`UTR clone of ATP synthase H+ transporting mitochondrial F0 complex subunit F2 (ATP5J2) nuclear gene encoding mitochondrial protein transcript variant 2

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ATP5MF
• Synonyms: ATP5J2; ATP5JL
• ACCN: NM_001003713
• Insert Size: 168 bp
• Sequence Data:
  Insert Sequence

  >SC201946 3'UTR clone of NM_001003713
  The sequence shown below is from the reference sequence of NM_001003713. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCTCCGCAAATACCACTGAAGAGGACACACTCTGCACCCCCCCACCCCACGACCTTGGCCCGAGCCCCTC
  CGTGAGGAACACAATCTCAATCGTTGCTGAATCCTTTCATATCCTAATAGGAATTAACCTCCAAATAAAA
  CATGACTGGTACGTGTGCTGATTGCCTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001003713.1
• Summary: Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. It is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, which comprises the proton channel. The catalytic portion of mitochondrial ATP synthase consists of five different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and single representatives of the gamma, delta, and epsilon subunits. The proton channel likely has nine subunits (a, b, c, d, e, f, g, F6 and 8). This gene encodes the f subunit of the Fo complex. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. This gene has multiple pseudogenes. Naturally occurring read-through transcription also exists between this gene and the downstream pentatricopeptide repeat domain 1 (PTCD1) gene. [provided by RefSeq, Nov 2010]
• Locus ID: 9551