GGT1 (NM_001032365) Human 3' UTR Clone

CAT#: SC201965

3`UTR clone of gamma-glutamyltransferase 1 (GGT1) transcript variant 5 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "GGT1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol GGT1
Synonyms CD224; D22S672; D22S732; GGT; GGT 1; GTG
ACCN NM_001032365
Insert Size 180 bp
Sequence Data
>SC201965 3'UTR clone of NM_001032365
The sequence shown below is from the reference sequence of NM_001032365. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TGCCTCGGACTCCAGGAAAGGCGGGGAGCCTGCCGGCTACTGAGTGCTCCAGGAGGACAAGGCTGACAAG
CAATCCAGGGACAAGATACTCACCAGGACCAGGAAGGGGACTCTGGGGGACCGGCTTCCCCTGTGAGCAG
CAGAGCAGCACAATAAATGAGGCCACTGTGCCAGGCTCCA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001032365.1
Summary 'The enzyme encoded by this gene is a type I gamma-glutamyltransferase that catalyzes the transfer of the glutamyl moiety of glutathione to a variety of amino acids and dipeptide acceptors. The enzyme is composed of a heavy chain and a light chain, which are derived from a single precursor protein. It is expressed in tissues involved in absorption and secretion and may contribute to the etiology of diabetes and other metabolic disorders. Multiple alternatively spliced variants have been identified. There are a number of related genes present on chromosomes 20 and 22, and putative pseudogenes for this gene on chromosomes 2, 13, and 22. [provided by RefSeq, Jan 2014]'
Locus ID 2678

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.