FXYD4 (NM_173160) Human 3' UTR Clone

CAT#: SC201971

3`UTR clone of FXYD domain containing ion transport regulator 4 (FXYD4) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: FXYD4
• Synonyms: CHIF
• ACCN: NM_173160
• Insert Size: 161
• Sequence Data:
  Insert Sequence

  >SC201971 3'UTR clone of NM_173160
  The sequence shown below is from the reference sequence of NM_173160. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TCTGCCACTACTTGCTGAGCACAGGACTGGCCTCCAGGGATGGCCTGAAGCCTAACACTGGCCCCCAGCA
  CCTCCTCCCCTGGGAGGCCTTATCCTCAAGGAAGGACTTCTCTCCAAGGGCAGGCTGTTAGGCCCCTTTC
  TGATCAGGAGGCTTCTTTATG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_173160.2
• Summary: This gene encodes a member of a family of small membrane proteins that share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. The approved human gene nomenclature for the family is FXYD-domain containing ion transport regulator. FXYD4, originally named CHIF for channel-inducing factor, has been shown to modulate the properties of the Na,K-ATPase, as has FXYD2, also known as the gamma subunit of the Na,K-ATPase, and FXYD7. Transmembrane topology has been established for FXYD4 and two family members (FXYD1 and FXYD2), with the N-terminus extracellular and the C-terminus on the cytoplasmic side of the membrane. Alternatively spliced transcript variants encoding the same protein have been found. [provided by RefSeq, May 2010]
• Locus ID: 53828