ALG5 (NM_001142364) Human 3' UTR Clone

CAT#: SC201973

3`UTR clone of asparagine-linked glycosylation 5 dolichyl-phosphate beta-glucosyltransferase homolog (S. cerevisiae) (ALG5) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ALG5
• Synonyms: bA421P11.2
• ACCN: NM_001142364
• Insert Size: 178
• Sequence Data:
  Insert Sequence

  >SC201973 3'UTR clone of NM_001142364
  The sequence shown below is from the reference sequence of NM_001142364. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGAGGCTTGAGCAAACTCGGAAAATGAATTAGGTTGTTTGCAGTCTTCAGTTGTGTTCTTATGCTTCAGT
  GTCACATTTCATTTCATTTGAAACTAAAATTTTAAGTAAAGCTGAAATAAACTTCTTGTCATTGTCTGCC
  TTTTGATAATTTTAAAGAAATAACTTTCCATAAGTAAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001142364.1
• Summary: This gene encodes a member of the glycosyltransferase 2 family. The encoded protein participates in glucosylation of the oligomannose core in N-linked glycosylation of proteins. The addition of glucose residues to the oligomannose core is necessary to ensure substrate recognition, and therefore, effectual transfer of the oligomannose core to the nascent glycoproteins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]
• Locus ID: 29880