Metallothionein (MT2A) (NM_005953) Human 3' UTR Clone

CAT#: SC202064

3`UTR clone of metallothionein 2A (MT2A) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MT2A
• Synonyms: MT-2; MT-II; MT2
• ACCN: NM_005953
• Insert Size: 162 bp
• Sequence Data:
  Insert Sequence

  >SC202064 3'UTR clone of NM_005953
  The sequence shown below is from the reference sequence of NM_005953. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CGTCGGACAAGTGCAGCTGCTGCGCCTGATGCTGGGACAGCCCCGCTCCCAGATGTAAAGAACGCGACTT
  CCACAAACCTGGATTTTTTATGTACAACCCTGACCGTGACCGTTTGCTATATTCCTTTTTCTATGAAATA
  ATGTGAATGATAATAAAACAGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_005953.3
• Summary: 'This gene is a member of the metallothionein family of genes. Proteins encoded by this gene family are low in molecular weight, are cysteine-rich, lack aromatic residues, and bind divalent heavy metal ions, altering the intracellular concentration of heavy metals in the cell. These proteins act as anti-oxidants, protect against hydroxyl free radicals, are important in homeostatic control of metal in the cell, and play a role in detoxification of heavy metals. The encoded protein interacts with the protein encoded by the homeobox containing 1 gene in some cell types, controlling intracellular zinc levels, affecting apoptotic and autophagy pathways. Some polymorphisms in this gene are associated with an increased risk of cancer. [provided by RefSeq, Sep 2017]'
• Locus ID: 4502