Archaemetzincin 2 (AMZ2) (NM_016627) Human 3' UTR Clone

CAT#: SC202137

3`UTR clone of archaelysin family metallopeptidase 2 (AMZ2) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: AMZ2
• Synonyms: archaelysin family metallopeptidase 2; archaemetzincin-2; archaemetzincins-2
• ACCN: NM_016627
• Insert Size: 222
• Sequence Data:
  Insert Sequence

  >SC202137 3'UTR clone of NM_016627
  The sequence shown below is from the reference sequence of NM_016627. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AAATGCCTGGCTGTTCTCCAAAAATGAGGACCTTCAAATAGGAGTGATTGAAATAAATAACTACTTGCAT
  GTTATGCTTTCATTTGGGTGGAATACTTCATTGGAATAAACTACTGATCTTGTGCTGTGTCAAAGTAACA
  GACTAGAACCTTCTTTCAAGTACCTGAATTGAAATGAAACTCATTTTGAATAATAAAAACTCTAGAAACT
  CTTTATCTTCTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_016627.4
• Summary: The protein encoded by this gene is a zinc metalloprotease that displays some activity against angiotensin-3. The encoded protein is inhibited by the aminopeptidase inhibitor amastatin, as well as by the general inhibitors o-phenanthroline and batimastat. Defects in this gene may be associated with lung tumorigenesis. [provided by RefSeq, Oct 2016]
• Locus ID: 51321