Ribonuclease Inhibitor (RNH1) (NM_002939) Human 3' UTR Clone

CAT#: SC202201

3`UTR clone of ribonuclease/angiogenin inhibitor 1 (RNH1) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: RNH1
• Synonyms: RAI; RNH
• ACCN: NM_002939
• Insert Size: 214 bp
• Sequence Data:
  Insert Sequence

  >SC202201 3'UTR clone of NM_002939
  The sequence shown below is from the reference sequence of NM_002939. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGGAGAAGGACAAGCCATCCCTGAGGGTCATCTCCTGAGGCTCTTCCTGCTGCTGCTCTCCCTGGACGAC
  CGGCCTCGAGGCAACCCTGGGGCCCACCAGCCCCTGCCATGCTCTCACCCTGCATATCCTAGGTTTGAAG
  AGAAACGCTCAGATCCGCTTATTTCTGCCAGTATATTTTGGACACTTTATAATCATTAAAGCACTTTCTT
  GGCA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002939.3
• Summary: 'Placental ribonuclease inhibitor (PRI) is a member of a family of proteinaceous cytoplasmic RNase inhibitors that occur in many tissues and bind to both intracellular and extracellular RNases (summarized by Lee et al., 1988 [PubMed 3219362]). In addition to control of intracellular RNases, the inhibitor may have a role in the regulation of angiogenin (MIM 105850). Ribonuclease inhibitor, of 50,000 Da, binds to ribonucleases and holds them in a latent form. Since neutral and alkaline ribonucleases probably play a critical role in the turnover of RNA in eukaryotic cells, RNH may be essential for control of mRNA turnover; the interaction of eukaryotic cells with ribonuclease may be reversible in vivo.[supplied by OMIM, Jul 2010]'
• Locus ID: 6050