Ribonuclease Inhibitor (RNH1) (NM_203386) Human 3' UTR Clone

CAT#: SC202202

3`UTR clone of ribonuclease/angiogenin inhibitor 1 (RNH1) transcript variant 5 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "RNH1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol RNH1
Synonyms RAI; RNH
ACCN NM_203386
Insert Size 214 bp
Sequence Data
>SC202202 3'UTR clone of NM_203386
The sequence shown below is from the reference sequence of NM_203386. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TGGAGAAGGACAAGCCATCCCTGAGGGTCATCTCCTGAGGCTCTTCCTGCTGCTGCTCTCCCTGGACGAC
CGGCCTCGAGGCAACCCTGGGGCCCACCAGCCCCTGCCATGCTCTCACCCTGCATATCCTAGGTTTGAAG
AGAAACGCTCAGATCCGCTTATTTCTGCCAGTATATTTTGGACACTTTATAATCATTAAAGCACTTTCTT
GGCA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_203386.1
Summary 'Placental ribonuclease inhibitor (PRI) is a member of a family of proteinaceous cytoplasmic RNase inhibitors that occur in many tissues and bind to both intracellular and extracellular RNases (summarized by Lee et al., 1988 [PubMed 3219362]). In addition to control of intracellular RNases, the inhibitor may have a role in the regulation of angiogenin (MIM 105850). Ribonuclease inhibitor, of 50,000 Da, binds to ribonucleases and holds them in a latent form. Since neutral and alkaline ribonucleases probably play a critical role in the turnover of RNA in eukaryotic cells, RNH may be essential for control of mRNA turnover; the interaction of eukaryotic cells with ribonuclease may be reversible in vivo.[supplied by OMIM, Jul 2010]'
Locus ID 6050

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.