AK2 (NM_001625) Human 3' UTR Clone

CAT#: SC202225

3`UTR clone of adenylate kinase 2 (AK2) transcript variant AK2A for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: AK2
• Synonyms: ADK2
• ACCN: NM_001625
• Insert Size: 215 bp
• Sequence Data:
  Insert Sequence

  >SC202225 3'UTR clone of NM_001625
  The sequence shown below is from the reference sequence of NM_001625. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCTTCTCCAAAGCCACATGTAAAGACTTGGTTATGTTTATCTAATGTTGGGTCCAAGAAGGAATTTCTTT
  CCATCCCTGTGAGGCAATGGGTGGGAATGATAGGACAGGCAAAGAGAAGCTTCCTCAGGCTAGCAAAAAT
  ATCATTTGATGTATTGATTAAAAAAGCACTTGCTTGATGTATCTTTGGCGTGTGTGCTACTCTCATCTGT
  GTGTA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001625.2
• Summary: 'Adenylate kinases are involved in regulating the adenine nucleotide composition within a cell by catalyzing the reversible transfer of phosphate groups among adenine nucleotides. Three isozymes of adenylate kinase, namely 1, 2, and 3, have been identified in vertebrates; this gene encodes isozyme 2. Expression of these isozymes is tissue-specific and developmentally regulated. Isozyme 2 is localized in the mitochondrial intermembrane space and may play a role in apoptosis. Mutations in this gene are the cause of reticular dysgenesis. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 1 and 2.[provided by RefSeq, Nov 2010]'
• Locus ID: 204