LAP2 (TMPO) (NM_003276) Human 3' UTR Clone

CAT#: SC202261

3`UTR clone of thymopoietin (TMPO) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TMPO
• Synonyms: CMD1T; LAP2; LEMD4; PRO0868; TP
• ACCN: NM_003276
• Insert Size: 222 bp
• Sequence Data:
  Insert Sequence

  >SC202261 3'UTR clone of NM_003276
  The sequence shown below is from the reference sequence of NM_003276. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AAGCGTGGAAATAAACACTAGTAAAATTAAGGACAAAAAGACATCTATCTTATCTTTCAGGTACTTTATG
  CCAACATTTTCTTTTCTGTTAAGGTTGTTTTAGTTTCCAGATAGGGCTAATTACAAAATGTTAAGCTTCT
  ACCCATCAAATTACAGTATAAAAGTAATTGCCTGTGTAGAACTACTTGTCTTTTCTAAAGATTTGCGTAG
  ATAGGAAGCCTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_003276.1
• Summary: 'Through alternative splicing, this gene encodes several distinct LEM domain containing protein isoforms. LEM domain proteins include inner nuclear membrane and intranuclear proteins, and are involved in a variety of cellular functions including gene expression, chromatin organization, and replication and cell cycle control. The encoded alpha isoform is broadly diffuse in the nucleus and contains a lamin binding domain, while the beta and gamma isoforms are localized to the nuclear membrane and contain an HDAC3 interaction domain. The distinct isoforms may compete with each other when acting to chaperone other proteins and regulate transcription. [provided by RefSeq, Aug 2019]'
• Locus ID: 7112