CACNA1G (NM_198397) Human 3' UTR Clone

CAT#: SC202290

3`UTR clone of calcium channel voltage-dependent T type alpha 1G subunit (CACNA1G) transcript variant 15 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CACNA1G
• Synonyms: Ca(V)T.1; Cav3.1; MGC117234; NBR13
• ACCN: NM_198397
• Insert Size: 227
• Sequence Data:
  Insert Sequence

  >SC202290 3'UTR clone of NM_198397
  The sequence shown below is from the reference sequence of NM_198397. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAAACAGAGGCTCAGAGAGGGTAAGGGGCTTGCCCAGGGCCACAGAGCTACATGGTGGAGCAGGAAGCAC
  ACGTGGCAGTGGGGGCAGGCAGCCCTGGATGTGAATCCTGTGCAAATCCTGACCCCACCATTGTCAGCTC
  AGTGACCTGGAGCAGCTGACTTACCAGGGCCTCAGTTTCATTAACTGGTGAATGGAGTCATAATAGAATC
  TCCTCGGAGGTCACAAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_198397.1
• Summary: Voltage-sensitive calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, gene expression, cell motility, cell division, and cell death. This gene encodes a T-type, low-voltage activated calcium channel. The T-type channels generate currents that are both transient, owing to fast inactivation, and tiny, owing to small conductance. T-type channels are thought to be involved in pacemaker activity, low-threshold calcium spikes, neuronal oscillations and resonance, and rebound burst firing. Many alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Sep 2011]
• Locus ID: 8913