UTY (NM_182659) Human 3' UTR Clone

CAT#: SC202307

3`UTR clone of ubiquitously transcribed tetratricopeptide repeat gene Y-linked (UTY) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol UTY
Synonyms KDM6AL; KDM6C; UTY1
ACCN NM_182659
Insert Size 228 bp
Sequence Data
>SC202307 3'UTR clone of NM_182659
The sequence shown below is from the reference sequence of NM_182659. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CAAAGTCTCAGATCCAAAGCTTTTTGAAATGATTAAGTAAGTGCCTTCTGAAACTGCTGCAGTTTCTCTT
TGGGGGTATTGGTAGCCATTCAGTATTTTTTTCAAAAGAATTCTGTTGACATTAAATGATATCAGCAGTC
CAGAAGTCTTGGCAAAATGTAATAAGATGTAAATAATCTTATATATTCATAAGTGTTATAAAATCTCATA
AGATTAAAATATTGCCTT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_182659.1
Summary 'This gene encodes a protein containing tetratricopeptide repeats which are thought to be involved in protein-protein interactions. The encoded protein is also a minor histocompatibility antigen which may induce graft rejection of male stem cell grafts. A large number of alternatively spliced transcripts have been observed for this gene, but the full length nature of some of these variants has not been determined. [provided by RefSeq, Apr 2012]'
Locus ID 7404

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.