FAF1 (NM_007051) Human 3' UTR Clone

CAT#: SC202315

3`UTR clone of Fas (TNFRSF6) associated factor 1 (FAF1) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "FAF1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol FAF1
Synonyms CGI-03; hFAF1; HFAF1s; UBXD12; UBXN3A
ACCN NM_007051
Insert Size 220
Sequence Data
>SC202315 3'UTR clone of NM_007051
The sequence shown below is from the reference sequence of NM_007051. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GTTGTTCCCTCAAGAAACCCTTTTCCTTGAAGCAAAAGAGTAAACACGGCCCAGCGGTGGAACCAGCCAT
TCCTTGACAAGCCAGCAGCCTGCGTCAGGAGAAGGGCTCCTCGCCAACCCACCCACACGCTCGTCTCACT
CAATTCAATGTCACACTTCTGCCTCTTGCAAAATTGCTGGAAAAAGTAATAATAAATATAGCTACTTAAG
ATTTCCCATC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_007051.2
Summary Interaction of Fas ligand (TNFSF6) with the FAS antigen (TNFRSF6) mediates programmed cell death, also called apoptosis, in a number of organ systems. The protein encoded by this gene binds to FAS antigen and can initiate apoptosis or enhance apoptosis initiated through FAS antigen. Initiation of apoptosis by the protein encoded by this gene requires a ubiquitin-like domain but not the FAS-binding domain. [provided by RefSeq, Jul 2008]
Locus ID 11124

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.