CD163L1 (NM_174941) Human 3' UTR Clone

CAT#: SC202389

3`UTR clone of CD163 molecule-like 1 (CD163L1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CD163L1
• Synonyms: CD163B; M160; SCARI2; WC1
• ACCN: NM_174941
• Insert Size: 199
• Sequence Data:
  Insert Sequence

  >SC202389 3'UTR clone of NM_174941
  The sequence shown below is from the reference sequence of NM_174941. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAGTTCTTCCTGCCTCTGAAGCCACAAAATGACTTTAGACTTCCAGGGCTCACCAGATCAACCTCTAAAT
  ATCTTTGAAGGAGACAACAACTTTTAAATGAATAAAGAGGAAGTCAAGTTGCCCTATGGAAAACTTGTCC
  AAATAACATTTCTTGAACAATAGGAGAACAGCTAAATTGATAAAGACTGGTGATAATAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_174941.4
• Summary: This gene encodes a member of the scavenger receptor cysteine-rich (SRCR) superfamily. Members of this family are secreted or membrane-anchored proteins mainly found in cells associated with the immune system. The SRCR family is defined by a 100-110 amino acid SRCR domain, which may mediate protein-protein interaction and ligand binding. The encoded protein contains twelve SRCR domains, a transmembrane region and a cytoplasmic domain. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2014]
• Locus ID: 283316