CAMK2D (NM_172129) Human 3' UTR Clone

CAT#: SC202400

3`UTR clone of calcium/calmodulin-dependent protein kinase II delta (CAMK2D) transcript variant 5 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CAMK2D
• Synonyms: CAMKD
• ACCN: NM_172129
• Insert Size: 168 bp
• Sequence Data:
  Insert Sequence

  >SC202400 3'UTR clone of NM_172129
  The sequence shown below is from the reference sequence of NM_172129. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTCACCAACAGTACCCATCAAGTAAATATTTCCAGGCTGTCAGCTTCTTTGTTAATACACCCATGGTCAG
  CTCCTTCTACTTATTCCATTGTTAATAGCATGGTATATGTTATTTAACGCTAGTAGTTGGTTACACTGAT
  GAAAATAAATGCCTTCACGGGAAAGGTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_172129.1
• Summary: 'The product of this gene belongs to the serine/threonine protein kinase family and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. Calcium signaling is crucial for several aspects of plasticity at glutamatergic synapses. In mammalian cells, the enzyme is composed of four different chains: alpha, beta, gamma, and delta. The product of this gene is a delta chain. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Distinct isoforms of this chain have different expression patterns.[provided by RefSeq, Nov 2008]'
• Locus ID: 817