CDK5 (NM_001164410) Human 3' UTR Clone

CAT#: SC202408

3`UTR clone of cyclin-dependent kinase 5 (CDK5) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "CDK5"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CDK5
Synonyms LIS7; PSSALRE
ACCN NM_001164410
Insert Size 221 bp
Sequence Data
>SC202408 3'UTR clone of NM_001164410
The sequence shown below is from the reference sequence of NM_001164410. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CCTACTTCTCCGACTTCTGTCCGCCCTAGGCCCCGGGACCCCCGGCCTCCAGGCTGGGGCCTGGCCTATT
TAAGCCCCCTCTTGAGAGGGGTGAGACAGTGGGGGTGCCTGGTGCGCTGTGCTCCAGCAGTGCTGGGCCC
AGCCAGGGTGGGGTGCCTGAGCCCGAATTTCTCACTCCCTTTGTGGACTTTATTTAATTTCATAAATTGG
CTCCTTTCCCA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001164410.1
Summary 'This gene encodes a proline-directed serine/threonine kinase that is a member of the cyclin-dependent kinase family of proteins. Unlike other members of the family, the protein encoded by this gene does not directly control cell cycle regulation. Instead the protein, which is predominantly expressed at high levels in mammalian postmitotic central nervous system neurons, functions in diverse processes such as synaptic plasticity and neuronal migration through phosphorylation of proteins required for cytoskeletal organization, endocytosis and exocytosis, and apoptosis. In humans, an allelic variant of the gene that results in undetectable levels of the protein has been associated with lethal autosomal recessive lissencephaly-7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2015]'
Locus ID 1020

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.