LCMT1 (NM_001032391) Human 3' UTR Clone

CAT#: SC202411

3`UTR clone of leucine carboxyl methyltransferase 1 (LCMT1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: LCMT1
• Synonyms: CGI-68; LCMT; PPMT1
• ACCN: NM_001032391
• Insert Size: 243
• Sequence Data:
  Insert Sequence

  >SC202411 3'UTR clone of NM_001032391
  The sequence shown below is from the reference sequence of NM_001032391. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGAAATGAGCTTGGGCTGAAGGAGATAACTTATTAATCTGTCGAAGGCTTATGCCGAGCCAGAAGCCGAA
  GCCACTTGCCCTCCTGGAGGAGACCTGCAAGCTCCCTGAGCGGTGGGCGGGCCTCGTCCGCAGGTCTCAT
  CCCACACTCTTGAGAAGCCTTGGTCACTACAGTGGTCGCACATGTTCCTCTTCCTGTTCCTGTTGACATG
  TCGTTGTTTAAATAAATCTCACTTGCCACCAGT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001032391.1
• Summary: LCMT1 catalyzes the methylation of the carboxyl group of the C-terminal leucine residue (leu309) of the catalytic subunit of protein phosphatase-2A (PPP2CA; MIM 176915) (De Baere et al., 1999 [PubMed 10600115]). [supplied by OMIM, Mar 2008]
• Locus ID: 51451