BRD7 (NM_013263) Human 3' UTR Clone

CAT#: SC202420

3`UTR clone of bromodomain containing 7 (BRD7) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: BRD7
• Synonyms: BP75; CELTIX1; NAG4
• ACCN: NM_013263
• Insert Size: 229
• Sequence Data:
  Insert Sequence

  >SC202420 3'UTR clone of NM_013263
  The sequence shown below is from the reference sequence of NM_013263. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGACGGATGTTGCTGAGTGTGGACCTGGTGGAAGTTGAGGCTGCCTGGTATTTGATTATATATTATGTAC
  ATACTTTTTCATTCTTAACTTAGAAATGCTTTTCAGAAGATATTAAATATTTGTAAATTGTGTTTTTAAT
  TAAACTTTGGAACAGCGAATTTGGATGTTCCAGAGGTTGGACTTGTATTAGGTAATAAAGCTGGACCTGG
  GACTCGTGAGGAAGGAATG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_013263.3
• Summary: This gene encodes a protein which is a member of the bromodomain-containing protein family. The product of this gene has been identified as a component of one form of the SWI/SNF chromatin remodeling complex, and as a protein which interacts with p53 and is required for p53-dependent oncogene-induced senescence which prevents tumor growth. Pseudogenes have been described on chromosomes 2, 3, 6, 13 and 14. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2010]
• Locus ID: 29117