Liver Carboxylesterase 1 (CES1) (NM_001025194) Human 3' UTR Clone

CAT#: SC202444

3`UTR clone of carboxylesterase 1 (monocyte/macrophage serine esterase 1) (CES1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CES1
• Synonyms: ACAT; CE-1; CEH; CES2; hCE-1; HMSE; HMSE1; PCE-1; REH; SES1; TGH
• ACCN: NM_001025194
• Insert Size: 200 bp
• Sequence Data:
  Insert Sequence

  >SC202444 3'UTR clone of NM_001025194
  The sequence shown below is from the reference sequence of NM_001025194. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCAGACAGAACACATAGAGCTGTGAATGAAGATCCAGCCGGCCTTGGGAGCCTGGAGGAGCAAAGACTGG
  GGTCTTTTGCGAAAGGGATTGCAGGTTCAGAAGGCATCTTACCATGGCTGGGGAATTGTCTGGTGGTGGG
  GGGCAGGGGACAGAGGCCATGAAGGAGCAAGTTTTGTATTTGTGACCTCAGCTTTGGGAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001025194.1
• Summary: 'This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They may participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. This enzyme is the major liver enzyme and functions in liver drug clearance. Mutations of this gene cause carboxylesterase 1 deficiency. Three transcript variants encoding three different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]'
• Locus ID: 1066