C4orf21 (ZGRF1) (NM_018392) Human 3' UTR Clone

CAT#: SC202466

3`UTR clone of chromosome 4 open reading frame 21 (C4orf21) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ZGRF1
• Synonyms: C4orf21
• ACCN: NM_018392
• Insert Size: 236
• Sequence Data:
  Insert Sequence

  >SC202466 3'UTR clone of NM_018392
  The sequence shown below is from the reference sequence of NM_018392. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAGTGAAAAAGAGAAATCTAAAGATAAATCTCATTCATAAAAAGACATGGTGTAAATATTTTGTATTTAT
  GTAAATTCAGACTCATTTTACATGATATATTTTTTATATTTTTATTACTCTAAACCCTCTTATTAAAAAT
  ATGATATTTAAATAACATAGTAAACACATGTAAAAATTTTGTTCTTCAAAAAAGTGTACAAAAGGTAGTA
  TAAAATCCTACTAATAAAAATAAGCT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_018392.4
• Summary: The encoded protein contains GRF zinc finger (zf-GRF) and transmembrane domains. GRF zinc fingers are found in a number of DNA-binding proteins. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2017]
• Locus ID: 55345