LLGL2 (NM_001015002) Human 3' UTR Clone

CAT#: SC202477

3`UTR clone of lethal giant larvae homolog 2 (Drosophila) (LLGL2) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "LLGL2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol LLGL2
Synonyms HGL; Hugl-2; LGL2
ACCN NM_001015002
Insert Size 192 bp
Sequence Data
>SC202477 3'UTR clone of NM_001015002
The sequence shown below is from the reference sequence of NM_001015002. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CAGCCAGTAGGAGAGCTTCGGGAGTGGGTGCCCAGGGTTAGGTGTGGGAGGCATGGGGCAGGACCATCAG
TAAAGACAGGGCCAGGTGCAGTGGCTCCTGCCTGTAACCCCAGTGCTGTGGGAGGCCAAGGTGGTAGGAT
CGCTTGAACCCAGGAGTTCAAGTCCAGCCTGGACAACGTAGGGAGACCCTTG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001015002.1
Summary 'The lethal (2) giant larvae protein of Drosophila plays a role in asymmetric cell division, epithelial cell polarity, and cell migration. This human gene encodes a protein similar to lethal (2) giant larvae of Drosophila. In fly, the protein's ability to localize cell fate determinants is regulated by the atypical protein kinase C (aPKC). In human, this protein interacts with aPKC-containing complexes and is cortically localized in mitotic cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]'
Locus ID 3993

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.