PGLS (NM_012088) Human 3' UTR Clone

CAT#: SC202504

3`UTR clone of 6-phosphogluconolactonase (PGLS) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PGLS
• Synonyms: 6PGL; HEL-S-304
• ACCN: NM_012088
• Insert Size: 208
• Sequence Data:
  Insert Sequence

  >SC202504 3'UTR clone of NM_012088
  The sequence shown below is from the reference sequence of NM_012088. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCTTCGAGAAGCATTCCACTTTGTAGCTGGCCAGAGGGACGCCGCAGCTGGGACCAGGCACGCGGCCCAT
  GGGGCTGGGCCCCTGCTGGCCGCCACTCTCCGGGCTCTCCTTTCAAAAAGCCACGTCGTGCTGCTGCTGG
  AAGCCAACAGCCTCCGGCCAGCAGCCCTACCCGGGGCTCAACACACAGGCTGTGGCTCTGGACATCCG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_012088.2
• Summary: Hydrolysis of 6-phosphogluconolactone to 6-phosphogluconate. [UniProtKB/Swiss-Prot Function]
• Locus ID: 25796