MDH2 (NM_005918) Human 3' UTR Clone

CAT#: SC202548

3`UTR clone of malate dehydrogenase 2 NAD (mitochondrial) (MDH2) nuclear gene encoding mitochondrial protein for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MDH2
• Synonyms: EIEE51; M-MDH; MDH; MGC:3559; MOR1
• ACCN: NM_005918
• Insert Size: 191 bp
• Sequence Data:
  Insert Sequence

  >SC202548 3'UTR clone of NM_005918
  The sequence shown below is from the reference sequence of NM_005918. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TCGTGAAGACCCTGAAGTGAGCCGCTGTGACGGGTGGCCAGTTTCCTTAATTTATGAAGGCATCATGTCA
  CTGCAAAGCCGTTGCAGATAAACTTTGTATTTTAATTTGCTTTGGTGATGATTACTGTATTGACATCATC
  ATGCCTTCCAAATTGTGGGTGGCTCTGTGGGCGCATCAATAAAAGCCGTCC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_005918.2
• Summary: 'Malate dehydrogenase catalyzes the reversible oxidation of malate to oxaloacetate, utilizing the NAD/NADH cofactor system in the citric acid cycle. The protein encoded by this gene is localized to the mitochondria and may play pivotal roles in the malate-aspartate shuttle that operates in the metabolic coordination between cytosol and mitochondria. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]'
• Locus ID: 4191