SCFD1 (NM_182835) Human 3' UTR Clone

CAT#: SC202565

3`UTR clone of sec1 family domain containing 1 (SCFD1) transcript variant 2 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "SCFD1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol SCFD1
Synonyms C14orf163; RA410; SLY1; SLY1P; STXBP1L2
ACCN NM_182835
Insert Size 211
Sequence Data
>SC202565 3'UTR clone of NM_182835
The sequence shown below is from the reference sequence of NM_182835. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

ACAGTTGTCACAACTTGGACAAAAGTAACACAGAAGAACCTTACTATGATAATCTACTTGGAATGTGGAT
AAATGTAAAAAGAAGAAAAGTTAGAAGAGCAATATGTTTCCTTCTCTGTAACAGTGTCCTAACAGTGAAA
ATCAGAGTTATTTGTTAATTTTTAAGGAAATTATATACTTAATATGTATTGATTAAAAGAAACATTTCAG
A

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_182835.1
Summary Plays a role in SNARE-pin assembly and Golgi-to-ER retrograde transport via its interaction with COG4. Involved in vesicular transport between the endoplasmic reticulum and the Golgi. [UniProtKB/Swiss-Prot Function]
Locus ID 23256

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.