FH (NM_000143) Human 3' UTR Clone

CAT#: SC202671

3`UTR clone of fumarate hydratase (FH) nuclear gene encoding mitochondrial protein for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: FH
• Synonyms: FMRD; HLRCC; HsFH; LRCC; MCL; MCUL1
• ACCN: NM_000143
• Insert Size: 250 bp
• Sequence Data:
  Insert Sequence

  >SC202671 3'UTR clone of NM_000143
  The sequence shown below is from the reference sequence of NM_000143. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACCTAAGGACATGCTGGGTCCAAAGTGATTTACATAAATTTATAATGAAAATAAACATGTATAAAATTTA
  AAAAAACAGACTCCCATTTCTTAAAAACGGATAAGTTTGAAAGGAAACTGCTATTGAACTTAAGCATCTC
  TAGCAGAGCAATTTGATCAGTATATAAAACCCTAGGATGTGCTAGGTCTAAGATGGATTAAACAAGTATA
  AAATAAAATACATTTATAAAATAAAAAGGAAAACAGACTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000143.2
• Summary: 'The protein encoded by this gene is an enzymatic component of the tricarboxylic acid (TCA) cycle, or Krebs cycle, and catalyzes the formation of L-malate from fumarate. It exists in both a cytosolic form and an N-terminal extended form, differing only in the translation start site used. The N-terminal extended form is targeted to the mitochondrion, where the removal of the extension generates the same form as in the cytoplasm. It is similar to some thermostable class II fumarases and functions as a homotetramer. Mutations in this gene can cause fumarase deficiency and lead to progressive encephalopathy. [provided by RefSeq, Jul 2008]'
• Locus ID: 2271