FLCN (NM_144606) Human 3' UTR Clone

CAT#: SC202688

3`UTR clone of folliculin (FLCN) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: FLCN
• Synonyms: BHD; DENND8B; FLCL
• ACCN: NM_144606
• Insert Size: 230
• Sequence Data:
  Insert Sequence

  >SC202688 3'UTR clone of NM_144606
  The sequence shown below is from the reference sequence of NM_144606. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGAACGAGCCTTCGGGAAGCTCACCCTCCGATCTCGGTGTGATTGTTGTGATTGTTGTGATTTCCTGTCT
  CGTTTGCCTTGACCGCCATGTGAAAGAATCTGTTCCCCAGCTAGGTGGGGAAAATTCACAGGTGGGCTGT
  CTGTAGAGAGAACTGGCTGATTAAAGGCTTCTCGTCCCGATTTTGTGATAGCCAAGTGCTTGGCCTGGTC
  GACGGTCTTTGCTCCTTTAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_144606.5
• Summary: This gene is located within the Smith-Magenis syndrome region on chromosome 17. Mutations in this gene are associated with Birt-Hogg-Dube syndrome, which is characterized by fibrofolliculomas, renal tumors, lung cysts, and pneumothorax. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
• Locus ID: 201163