RASGRP2 (NM_153819) Human 3' UTR Clone

CAT#: SC202693

3`UTR clone of RAS guanyl releasing protein 2 (calcium and DAG-regulated) (RASGRP2) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: RASGRP2
• Synonyms: CALDAG-GEFI; CDC25L
• ACCN: NM_153819
• Insert Size: 250
• Sequence Data:
  Insert Sequence

  >SC202693 3'UTR clone of NM_153819
  The sequence shown below is from the reference sequence of NM_153819. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TACAGACGGTGGAGGATGGGGTGTTTGACATCCACTTGTAATAGATGCTGTGGTTGGATCAAGGACTCAT
  TCCTGCCTTGGAGAAAATACTTCAACCAGAGCAGGGAGCCTGGGGGTGTCGGGGCAGGAGGCTGGGGATG
  GGGGTGGGATATGAGGGTGGCATGCAGCTGAGGGCAGGGCCAGGGCTGGTGTCCCTAAGGTTGTACAGAC
  TCTTGTGAATATTTGTATTTTCCAGATGGAATAAAAAGGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_153819.1
• Summary: The protein encoded by this gene is a brain-enriched nucleotide exchanged factor that contains an N-terminal GEF domain, 2 tandem repeats of EF-hand calcium-binding motifs, and a C-terminal diacylglycerol/phorbol ester-binding domain. This protein can activate small GTPases, including RAS and RAP1/RAS3. The nucleotide exchange activity of this protein can be stimulated by calcium and diacylglycerol. Four alternatively spliced transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
• Locus ID: 10235