DLL3 (NM_203486) Human 3' UTR Clone

CAT#: SC202742

3`UTR clone of delta-like 3 (Drosophila) (DLL3) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: DLL3
• Synonyms: SCDO1
• ACCN: NM_203486
• Insert Size: 231
• Sequence Data:
  Insert Sequence

  >SC202742 3'UTR clone of NM_203486
  The sequence shown below is from the reference sequence of NM_203486. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TCTGCTCCTTCCATCTACGCTCGGGAGGCCTGACGCGTCTCCTCCATCCGCACCTGGAGTCAGAGCGTGG
  ATTTTTGTATTTGCTCGGTGGTGCCCAGTCTCTGCCCCAGAGGCTTTGGAGTTCAATCTTGAAGGGGTGT
  CTGGGGGAACTTTACTGTTGCAAGTTGTAAATAATGGTTATTTATATCCTATTTTTTCTCACCCCATCTC
  TCTAGAAACACCTATAAAGGC
  
  CGGACCGTTACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-RsrII
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_203486.2
• Summary: This gene encodes a member of the delta protein ligand family. This family functions as Notch ligands that are characterized by a DSL domain, EGF repeats, and a transmembrane domain. Mutations in this gene cause autosomal recessive spondylocostal dysostosis 1. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
• Locus ID: 10683