Relaxin 2 (RLN2) (NM_134441) Human 3' UTR Clone

CAT#: SC202745

3`UTR clone of relaxin 2 (RLN2) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: RLN2
• Synonyms: bA12D24.1.1; bA12D24.1.2; H2; H2-RLX; RLXH2
• ACCN: NM_134441
• Insert Size: 257 bp
• Sequence Data:
  Insert Sequence

  >SC202745 3'UTR clone of NM_134441
  The sequence shown below is from the reference sequence of NM_134441. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTTGCCATGTTGGTTGTACCAAAAGATCTCTTGCTAGATTTTGCTGAGATGAAGCTAATTGTGCACATCT
  CGTATAATATTCACACATATTCTTAATGACATTTCACTGATGCTTCTATCAGGTCCCATCAATTCTTAGA
  ATATCTAAGAATCTTTGTTAGATATTAGGTCCCATCAATTCTTAGAATATCTAAACATCTTTGTTGATGT
  TTAGATTTTTTTATTTGATGTGTAAGAAAATGTTCTTTGTGTGATTA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_134441.1
• Summary: 'This gene encodes a member of the relaxin subfamily and insulin superfamily of peptide hormones. In humans there are three non-allelic relaxin genes. This gene encodes multiple protein isoforms, at least one of which undergoes proteolytic processing. This processing generates relaxin A and B chains that are linked by disulfide bonds to form the mature peptide hormone. This hormone plays a role in the male and female reproductive systems and was initially noted for its role in pregnancy. This protein also plays broader roles in the cardiovascular system, including in the regulation of blood pressure and control of heart rate, and data from animal models shows that this protein may have anti-fibrotic and cardioprotective effects. [provided by RefSeq, Jul 2016]'
• Locus ID: 6019