CPT1A (NM_001031847) Human 3' UTR Clone

CAT#: SC202748

3`UTR clone of carnitine palmitoyltransferase 1A (liver) (CPT1A) nuclear gene encoding mitochondrial protein transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CPT1A
• Synonyms: CPT1; CPT1-L; L-CPT1
• ACCN: NM_001031847
• Insert Size: 192 bp
• Sequence Data:
  Insert Sequence

  >SC202748 3'UTR clone of NM_001031847
  The sequence shown below is from the reference sequence of NM_001031847. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGTCAAGGACCAAGTTCAGATACTTGAGACAAAGTGGAAAGTCTCAGCATATGGAAACAAGGCCTTGGAG
  GAGACCATGGACATCACCAAGTTCATGTGCTGGGCTGGAAAGAAAAGCCTGTTGATTTTCACTTGCTGTG
  CATTTATTCATCCATTCCATTGCCTCAATGCTGAGAACAGTGCCTGACACAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001031847.2
• Summary: 'The mitochondrial oxidation of long-chain fatty acids is initiated by the sequential action of carnitine palmitoyltransferase I (which is located in the outer membrane and is detergent-labile) and carnitine palmitoyltransferase II (which is located in the inner membrane and is detergent-stable), together with a carnitine-acylcarnitine translocase. CPT I is the key enzyme in the carnitine-dependent transport across the mitochondrial inner membrane and its deficiency results in a decreased rate of fatty acid beta-oxidation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]'
• Locus ID: 1374