GCS1 (MOGS) (NM_001146158) Human 3' UTR Clone

CAT#: SC202792

3`UTR clone of mannosyl-oligosaccharide glucosidase (MOGS) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MOGS
• Synonyms: CDG2B; CWH41; DER7; GCS1
• ACCN: NM_001146158
• Insert Size: 233
• Sequence Data:
  Insert Sequence

  >SC202792 3'UTR clone of NM_001146158
  The sequence shown below is from the reference sequence of NM_001146158. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GACCAGCCTTGTCTTACTGGCCATGGCTGAAGACTACTGAAGGGAGGGAGAGGAGGGGAGCCAAGACACT
  CATGCCACTCTGGCTCTGAAGGGACAAAGGCTTCTGGCTTTTGCCCCCAGCCCCTTGGATACCAGTAATT
  CAAACCTTCCTCATTTCATCTCAGGTGTCTCCTTGCTGTCATCCCACATAGCCCTGGGGTGAATGTGAAT
  CCAGAGTCTATTTTTCTAAATAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001146158.1
• Summary: This gene encodes the first enzyme in the N-linked oligosaccharide processing pathway. The enzyme cleaves the distal alpha-1,2-linked glucose residue from the Glc(3)-Man(9)-GlcNAc(2) oligosaccharide precursor. This protein is located in the lumen of the endoplasmic reticulum. Defects in this gene are a cause of type IIb congenital disorder of glycosylation (CDGIIb). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
• Locus ID: 7841