ATG4C (NM_178221) Human 3' UTR Clone

CAT#: SC202821

3`UTR clone of ATG4 autophagy related 4 homolog C (S. cerevisiae) (ATG4C) transcript variant 8 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ATG4C
• Synonyms: APG4-C; APG4C; AUTL1; AUTL3
• ACCN: NM_178221
• Insert Size: 248
• Sequence Data:
  Insert Sequence

  >SC202821 3'UTR clone of NM_178221
  The sequence shown below is from the reference sequence of NM_178221. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TTAGCACGGAAGAGTTTGTCTTGCTTTAAAGATTAGCACATTTGTGCTTGATAAGAAGAATTCCATTGAA
  AGGGGAAAAATGAAGAGAAACAAGTATATCTGAAATGTTTATTTTCACAAATATCTTAATTTTATATGTT
  CTTTAAAAAAGAACATTTGAAAATATAACAGTTAAAGATATTTTTCTAAAAGAGAAATGATTTAATGAAT
  CTTGCTTTCTAATAAATAAATTGAGTGATTCTGGTTGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_178221.1
• Summary: Autophagy is the process by which endogenous proteins and damaged organelles are destroyed intracellularly. Autophagy is postulated to be essential for cell homeostasis and cell remodeling during differentiation, metamorphosis, non-apoptotic cell death, and aging. Reduced levels of autophagy have been described in some malignant tumors, and a role for autophagy in controlling the unregulated cell growth linked to cancer has been proposed. This gene encodes a member of the autophagin protein family. The encoded protein is also designated as a member of the C-54 family of cysteine proteases. Alternate transcriptional splice variants, encoding the same protein, have been characterized. [provided by RefSeq, Jul 2008]
• Locus ID: 84938