SULT1A1 (NM_177530) Human 3' UTR Clone

CAT#: SC202854

3`UTR clone of sulfotransferase family cytosolic 1A phenol-preferring member 1 (SULT1A1) transcript variant 3

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SULT1A1
• Synonyms: HAST1/HAST2; P-PST; PST; ST1A1; ST1A3; STP; STP1; TSPST1
• ACCN: NM_177530
• Insert Size: 245 bp
• Sequence Data:
  Insert Sequence

  >SC202854 3'UTR clone of NM_177530
  The sequence shown below is from the reference sequence of NM_177530. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CGGAGAAGATGGCAGGCTGCAGCCTCAGCTTCCGCTCTGAGCTGTGAGAGGGGCTCCTGGAGTCACTGCA
  GAGGGAGTGTGCGAATCAAACCTGACCAAGCGGCTCAAGAATAAAATATGAATTGAGGGCCCGGGACGGT
  AGGTCATGTCTGTAATCCCAGCAATTTGGAGGCTGAGGTGGGAGGATCATTTGAGCCCAGGAGTTCGAGA
  CCAACCTGGGCAACATAGTGAGATTCTGTTAAAAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_177530.1
• Summary: 'Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene encodes one of two phenol sulfotransferases with thermostable enzyme activity. Multiple alternatively spliced variants that encode two isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]'
• Locus ID: 6817