PFKP (NM_002627) Human 3' UTR Clone

CAT#: SC202860

3`UTR clone of phosphofructokinase platelet (PFKP) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PFKP
• Synonyms: ATP-PFK; PFK-C; PFK-P; PFKF
• ACCN: NM_002627
• Insert Size: 241 bp
• Sequence Data:
  Insert Sequence

  >SC202860 3'UTR clone of NM_002627
  The sequence shown below is from the reference sequence of NM_002627. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGCCCTGGAGTGTCTGACCCAGTCCCGCCTGCATGTGCCTGCAGCCACCGTGGACTGTCTGTTTTTGTAA
  CACTTAAGTTATTTTATCAGCACTTTATGCACGTATTATTGACATTAATACCTAATCGGCGAGTGCCCAT
  CTGCCCCACCTGCTCCAGTGCGTGCTGTCTGTGGAGTGTGTCTCATGCTTTCAGATGTGCATATGAGCAG
  AATTAATTAAACATTTGCCTATGACTCCAAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002627.3
• Summary: 'This gene encodes a member of the phosphofructokinase A protein family. The encoded enzyme is the platelet-specific isoform of phosphofructokinase and plays a key role in glycolysis regulation. This gene may play a role in metabolic reprogramming in some cancers, including clear cell renal cell carcinomas, and cancer of the bladder, breast, and lung. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]'
• Locus ID: 5214