DUSP23 (NM_017823) Human 3' UTR Clone

CAT#: SC202870

3`UTR clone of dual specificity phosphatase 23 (DUSP23) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: DUSP23
• Synonyms: DUSP25; LDP-3; LDP3; MOSP; VHZ
• ACCN: NM_017823
• Insert Size: 220
• Sequence Data:
  Insert Sequence

  >SC202870 3'UTR clone of NM_017823
  The sequence shown below is from the reference sequence of NM_017823. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAGGAGAAAGCAGTCTTCCAGTTCTACCAGCGAACGAAATAAGGGGCCTTAGTACCCTTCTACCAGGCCC
  TCACTCCCCTTCCCCATGTTGTCGATGGGGCCAGAGATGAAGGGAAGTGGACTAAAGTATTAAACCCTCT
  AGCTCCCATTGGCTGAAGACACTGAAGTAGCCCACCCCTGCAGGCAGGTCCTGATTGAAGGGGAGGCTTG
  TACTGCTTTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_017823.3
• Summary: Protein phosphatase that mediates dephosphorylation of proteins phosphorylated on Tyr and Ser/Thr residues. In vitro, it can dephosphorylate p44-ERK1 (MAPK3) but not p54 SAPK-beta (MAPK10) in vitro. Able to enhance activation of JNK and p38 (MAPK14). [UniProtKB/Swiss-Prot Function]
• Locus ID: 54935