DUSP23 (NM_017823) Human 3' UTR Clone

CAT#: SC202870

3`UTR clone of dual specificity phosphatase 23 (DUSP23) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "DUSP23"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol DUSP23
Synonyms DUSP25; LDP-3; LDP3; MOSP; VHZ
ACCN NM_017823
Insert Size 220
Sequence Data
>SC202870 3'UTR clone of NM_017823
The sequence shown below is from the reference sequence of NM_017823. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CAGGAGAAAGCAGTCTTCCAGTTCTACCAGCGAACGAAATAAGGGGCCTTAGTACCCTTCTACCAGGCCC
TCACTCCCCTTCCCCATGTTGTCGATGGGGCCAGAGATGAAGGGAAGTGGACTAAAGTATTAAACCCTCT
AGCTCCCATTGGCTGAAGACACTGAAGTAGCCCACCCCTGCAGGCAGGTCCTGATTGAAGGGGAGGCTTG
TACTGCTTTG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_017823.3
Summary Protein phosphatase that mediates dephosphorylation of proteins phosphorylated on Tyr and Ser/Thr residues. In vitro, it can dephosphorylate p44-ERK1 (MAPK3) but not p54 SAPK-beta (MAPK10) in vitro. Able to enhance activation of JNK and p38 (MAPK14). [UniProtKB/Swiss-Prot Function]
Locus ID 54935

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.