FAM108A1 (ABHD17A) (NM_031213) Human 3' UTR Clone

CAT#: SC202901

3`UTR clone of family with sequence similarity 108 member A1 (FAM108A1) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ABHD17A
• Synonyms: C19orf27; FAM108A1
• ACCN: NM_031213
• Insert Size: 242
• Sequence Data:
  Insert Sequence

  >SC202901 3'UTR clone of NM_031213
  The sequence shown below is from the reference sequence of NM_031213. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TCGCTTCATCTCCCAGGAGCTGCCCAGCCAGCGCGCCTAGCGGCGGCCCCAACCGGCCGGACCTCAGCAA
  TAAGGCGGCCCCCGGACCTCACCCCGCGCCGGCCCCCACCCAGGGGCTGCATGTGGACCCCCCGGGCGGC
  CCAGGGGACCCCGCCCCGACCCAGGGGCTGTGGACGATGTACAGGCAACAGAGCTACGCACTCCTTTCCT
  TTTGGAAGCAAGAAGAAAATACGTGAAAACGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_031213.3
• Locus ID: 81926