SGLT2 (SLC5A2) (NM_003041) Human 3' UTR Clone

CAT#: SC202921

3`UTR clone of solute carrier family 5 (sodium/glucose cotransporter) member 2 (SLC5A2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SLC5A2
• Synonyms: SGLT2
• ACCN: NM_003041
• Insert Size: 236
• Sequence Data:
  Insert Sequence

  >SC202921 3'UTR clone of NM_003041
  The sequence shown below is from the reference sequence of NM_003041. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGTTCCTCTGGGGCTTCTATGCCTAAGACCAACTGCGTTGGACACCATAAGCCACAGCCTCACAGGAAGT
  GGGGGTGAGGAGCCTGCGGTGCTCCCCAGAAAAGGGGAAGGGGCAGTGGGGTGAGAAGGTCCTGGCTCCC
  CTTCTCCCGGCCTTCCTCTGCCTGGGGCCCACTGCATCTGATTGGCAGTCACTTCCCATGAGGGCCTGGC
  CCACCCGCTGCAGTTGCCCTAAGGAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_003041.3
• Summary: This gene encodes a member of the sodium glucose cotransporter family which are sodium-dependent glucose transport proteins. The encoded protein is the major cotransporter involved in glucose reabsorption in the kidney. Mutations in this gene are associated with renal glucosuria. Two transcript variants, one protein-coding and one not, have been found for this gene. [provided by RefSeq, Feb 2015]
• Locus ID: 6524