alpha Sarcoglycan (SGCA) (NM_001135697) Human 3' UTR Clone

CAT#: SC202924

3`UTR clone of sarcoglycan alpha (50kDa dystrophin-associated glycoprotein) (SGCA) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SGCA
• Synonyms: 50DAG; adhalin; ADL; DAG2; DMDA2; LGMD2D; LGMDR3; SCARMD1
• ACCN: NM_001135697
• Insert Size: 230 bp
• Sequence Data:
  Insert Sequence

  >SC202924 3'UTR clone of NM_001135697
  The sequence shown below is from the reference sequence of NM_001135697. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CATTCTGGACCAGCACTGACAGCCCAGCCAGTGGTTCCAGGTCCAGCCCTGACTTCATCCTCCCTTCTCT
  GTCCACACCACGAGTGGCACATCCCACCTGCTGATTCCAGCTCCTGGCCCTCCTGGAACCCAGGCTCTAA
  ACAAGCAGGGAGAGGGGGTGGGGTGGGGTGAGAGTGTGTGGAGTAAGGACATTCAGAATAAATATCTGCT
  GCTCTGCTCACCAATTGCTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001135697.1
• Summary: 'This gene encodes a component of the dystrophin-glycoprotein complex (DGC), which is critical to the stability of muscle fiber membranes and to the linking of the actin cytoskeleton to the extracellular matrix. Its expression is thought to be restricted to striated muscle. Mutations in this gene result in type 2D autosomal recessive limb-girdle muscular dystrophy. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]'
• Locus ID: 6442