DLK (DLK1) (NM_003836) Human 3' UTR Clone

CAT#: SC202971

3`UTR clone of delta-like 1 homolog (Drosophila) (DLK1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: DLK1
• Synonyms: Delta1; DLK; DLK-1; FA1; pG2; Pref-1; PREF1; ZOG
• ACCN: NM_003836
• Insert Size: 248
• Sequence Data:
  Insert Sequence

  >SC202971 3'UTR clone of NM_003836
  The sequence shown below is from the reference sequence of NM_003836. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ATGACCACCTTCAGCAAGGAGGCCGGCGACGAGGAGATCTAAGCAGCGTTCCCACAGCCCCCTCTAGATT
  CTTGGAGTTCCGCAGAGCTTACTATACGCGGTCTGTCCTAATCTTTGTGGTGTTCGCTATCTCTTGTGTC
  AAATCTGGTGAACGCTACGCTTACATATATTGTCTTTGTGCTGCTGTGTGACAAACGCAATGCAAAAACA
  ATCCTCTTTCTCTCTCTTAATGCATGATACAGAATAAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_003836.5
• Summary: This gene encodes a transmembrane protein that contains multiple epidermal growth factor repeats that functions as a regulator of cell growth. The encoded protein is involved in the differentiation of several cell types including adipocytes. This gene is located in a region of chromosome 14 frequently showing unparental disomy, and is imprinted and expressed from the paternal allele. A single nucleotide variant in this gene is associated with child and adolescent obesity and shows polar overdominance, where heterozygotes carrying an active paternal allele express the phenotype, while mutant homozygotes are normal. [provided by RefSeq, Nov 2015]
• Locus ID: 8788