NR2C1 (NM_001032287) Human 3' UTR Clone

CAT#: SC202972

3`UTR clone of nuclear receptor subfamily 2 group C member 1 (NR2C1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NR2C1
• Synonyms: TR2
• ACCN: NM_001032287
• Insert Size: 207 bp
• Sequence Data:
  Insert Sequence

  >SC202972 3'UTR clone of NM_001032287
  The sequence shown below is from the reference sequence of NM_001032287. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTCTTCAACAAGCAGAGGGGTAATCACCTTAAAATGTCATCAAAAATAGATCTACTAGAAGGCAGCATCA
  CATTCCCATCTTACTTATGGACTCCTACCCCTGGTTCATGTCTTATATGCCTGTAATGGTTATAAAGCCT
  ACCTTCAGGAAAGCTATGGTTGACTAATTACTAATGGATGGGTTTTAAACATGTCCCTCTACAATAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001032287.2
• Summary: 'This gene encodes a nuclear hormone receptor characterized by a highly conserved DNA binding domain (DBD), a variable hinge region, and a carboxy-terminal ligand binding domain (LBD) that is typical for all members of the steroid/thyroid hormone receptor superfamily. This protein also belongs to a large family of ligand-inducible transcription factors that regulate gene expression by binding to specific DNA sequences within promoters of target genes. Multiple alternatively spliced transcript variants have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]'
• Locus ID: 7181