GH2 (NM_022557) Human 3' UTR Clone

CAT#: SC203017

3`UTR clone of growth hormone 2 (GH2) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol GH2
Synonyms GH-V; GHB2; GHL; GHV; hGH-V
ACCN NM_022557
Insert Size 259 bp
Sequence Data
>SC203017 3'UTR clone of NM_022557
The sequence shown below is from the reference sequence of NM_022557. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGCAGATCTTCAATCAGTCCTACAGCAAGTTTGACACAAAATCGCACAACGATGACGCACTGCTCAAGAA
CTACGGGCTGCTCTACTGCTTCAGGAAGGACATGGACAAGGTCGAGACATTCCTGCGCATCGTGCAGTGC
CGCTCTGTGGAGGGCAGCTGTGGCTTCTAGCTGCCCGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTC
TCCTGGTCGTGGAAGGTGCTACTCCAGTGCCCACCAGCCTTGTCCTAAT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_022557.2
Summary 'The protein encoded by this gene is a member of the somatotropin/prolactin family of hormones which play an important role in growth control. The gene, along with four other related genes, is located at the growth hormone locus on chromosome 17 where they are interspersed in the same transcriptional orientation; an arrangement which is thought to have evolved by a series of gene duplications. The five genes share a remarkably high degree of sequence identity. Alternative splicing generates additional isoforms of each of the five growth hormones, leading to further diversity and potential for specialization. As in the case of its pituitary counterpart, growth hormone 1, the predominant isoform of this particular family member shows similar somatogenic activity, with reduced lactogenic activity. Mutations in this gene lead to placental growth hormone/lactogen deficiency. [provided by RefSeq, Jul 2008]'
Locus ID 2689

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.