TPM1 (NM_000366) Human 3' UTR Clone

CAT#: SC203049

3`UTR clone of tropomyosin 1 (alpha) (TPM1) transcript variant 5 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "TPM1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol TPM1
Synonyms C15orf13; CMD1Y; CMH3; HEL-S-265; HTM-alpha; LVNC9; TMSA
ACCN NM_000366
Insert Size 260 bp
Sequence Data
>SC203049 3'UTR clone of NM_000366
The sequence shown below is from the reference sequence of NM_000366. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GCTGGACCACGCTCTCAACGATATGACTTCCATGTAAACGTTCATCCACTCTGCCTGCTTACACCCTGCC
CTCATGCTAATATAAGTTTCTTTGCTTCACTTCTCCCAAGACTCCCTCGTCGAGCTGGATGTCCCACCTC
TCTGAGCTCTGCATTTGTCTATTCTCCAGCTGACCCTGGTTCTCTCTCTTAGCATCCTGCCTTAGAGCCA
GGCACACACTGTGCTTTCTATTGTACAGAAGCTCTTCGTTTCAGTGTCAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_000366.5
Summary 'This gene is a member of the tropomyosin family of highly conserved, widely distributed actin-binding proteins involved in the contractile system of striated and smooth muscles and the cytoskeleton of non-muscle cells. Tropomyosin is composed of two alpha-helical chains arranged as a coiled-coil. It is polymerized end to end along the two grooves of actin filaments and provides stability to the filaments. The encoded protein is one type of alpha helical chain that forms the predominant tropomyosin of striated muscle, where it also functions in association with the troponin complex to regulate the calcium-dependent interaction of actin and myosin during muscle contraction. In smooth muscle and non-muscle cells, alternatively spliced transcript variants encoding a range of isoforms have been described. Mutations in this gene are associated with type 3 familial hypertrophic cardiomyopathy. [provided by RefSeq, Jul 2008]'
Locus ID 7168

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.