KCNQ3 (NM_004519) Human 3' UTR Clone

CAT#: SC203132

3`UTR clone of potassium voltage-gated channel KQT-like subfamily member 3 (KCNQ3) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: KCNQ3
• Synonyms: BFNC2; EBN2; KV7.3
• ACCN: NM_004519
• Insert Size: 274
• Sequence Data:
  Insert Sequence

  >SC203132 3'UTR clone of NM_004519
  The sequence shown below is from the reference sequence of NM_004519. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCCTTCCAATAAGCCCATTTAAAAGAGGTCACTGGCTGACCCCTCCTTGTAATGTAGACAGACTTTGTAT
  AGTTCACTTACTCTTACACCCGACGCTTACCAGCGGGGACACCAATGGCTGCATCAAATGCATGCGTGTG
  CGTGGTGGCCCCACCCAGGCAGGGGCTTCCCACAGCCTCTTCCTCCCCATGTCACCACAACAAAGTGCTT
  CCTTTTCAGCATGGTTTGCATGACTTTACACTATATAAATGGTTCCGCTAATCTCTTCTAGGAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_004519.2
• Summary: This gene encodes a protein that functions in the regulation of neuronal excitability. The encoded protein forms an M-channel by associating with the products of the related KCNQ2 or KCNQ5 genes, which both encode integral membrane proteins. M-channel currents are inhibited by M1 muscarinic acetylcholine receptors and are activated by retigabine, a novel anti-convulsant drug. Defects in this gene are a cause of benign familial neonatal convulsions type 2 (BFNC2), also known as epilepsy, benign neonatal type 2 (EBN2). Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
• Locus ID: 3786