BAT5 (ABHD16A) (NM_021160) Human 3' UTR Clone

CAT#: SC203140

3`UTR clone of HLA-B associated transcript 5 (BAT5) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ABHD16A"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ABHD16A
Synonyms BAT5; D6S82E; hBAT5; NG26; PP199
ACCN NM_021160
Insert Size 260
Sequence Data
>SC203140 3'UTR clone of NM_021160
The sequence shown below is from the reference sequence of NM_021160. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CAGAACTTCCAGATGCCCTGGCACCTCTAGGGACCAACTGGGACTCATTATGGAAGAATGGGGTGAGAGG
AGACATGAGGAAAGACCCTCTTATTTGTGATTCTCTGTGTTCATGTTGCTGTTTATAGTTTGTGGAAAGT
GGGGGACCATCCCCCTTCTCACCACTGTTCCTCTTGCACGTTTCCCCTCATTCATGTGGCTGTACTTAAC
CTTCTCCAACATACATCCTGCATTACATGAATGGATTATTCCTAATAATT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_021160.1
Summary A cluster of genes, BAT1-BAT5, has been localized in the vicinity of the genes for tumor necrosis factor alpha and tumor necrosis factor beta. These genes are all within the human major histocompatibility complex class III region. The protein encoded by this gene is thought to be involved in some aspects of immunity. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2010]
Locus ID 7920

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.