TRPM3 (NM_001007470) Human 3' UTR Clone

CAT#: SC203168

3`UTR clone of transient receptor potential cation channel subfamily M member 3 (TRPM3) transcript variant 8 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TRPM3
• Synonyms: GON-2; LTRPC3; MLSN2
• ACCN: NM_001007470
• Insert Size: 240 bp
• Sequence Data:
  Insert Sequence

  >SC203168 3'UTR clone of NM_001007470
  The sequence shown below is from the reference sequence of NM_001007470. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TACTCAGAAGAAGGCGGGTAGGTAACTTTCCAGGCCCCATGGAAGAACCCTAAAGCCTGTTTGGAAACGA
  GGGTATGAGTGGATTATGTTTTCAGTAGCTCAACCAAGACCTCAAATCAAAACAAGCTATGAACAAATTG
  TCTAAAAAATGTCTGTCATGGGAGGGCTGTGGTGAAGAACAGAGAAACATATTCTAAATGTCCTGTGAAG
  TGGGAAATTCTATGAAAGCTACACGGATAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001007470.1
• Summary: The product of this gene belongs to the family of transient receptor potential (TRP) channels. TRP channels are cation-selective channels important for cellular calcium signaling and homeostasis. The protein encoded by this gene mediates calcium entry, and this entry is potentiated by calcium store depletion. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
• Locus ID: 80036