TRPM3 (NM_206948) Human 3' UTR Clone

CAT#: SC203170

3`UTR clone of transient receptor potential cation channel subfamily M member 3 (TRPM3) transcript variant 7 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "TRPM3"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol TRPM3
Synonyms GON-2; LTRPC3; MLSN2
ACCN NM_206948
Insert Size 240
Sequence Data
>SC203170 3'UTR clone of NM_206948
The sequence shown below is from the reference sequence of NM_206948. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TACTCAGAAGAAGGCGGGTAGGTAACTTTCCAGGCCCCATGGAAGAACCCTAAAGCCTGTTTGGAAACGA
GGGTATGAGTGGATTATGTTTTCAGTAGCTCAACCAAGACCTCAAATCAAAACAAGCTATGAACAAATTG
TCTAAAAAATGTCTGTCATGGGAGGGCTGTGGTGAAGAACAGAGAAACATATTCTAAATGTCCTGTGAAG
TGGGAAATTCTATGAAAGCTACACGGATAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_206948.2
Summary The product of this gene belongs to the family of transient receptor potential (TRP) channels. TRP channels are cation-selective channels important for cellular calcium signaling and homeostasis. The protein encoded by this gene mediates calcium entry, and this entry is potentiated by calcium store depletion. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Locus ID 80036

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.