PDE9A (NM_001001576) Human 3' UTR Clone

CAT#: SC203213

3`UTR clone of phosphodiesterase 9A (PDE9A) transcript variant 11 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "PDE9A"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol PDE9A
Synonyms HSPDE9A2
ACCN NM_001001576
Insert Size 210 bp
Sequence Data
>SC203213 3'UTR clone of NM_001001576
The sequence shown below is from the reference sequence of NM_001001576. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AGTGAAGGAGACTGTGCCTGAGGAAAGCGGGGGGCGTGGCTGCAGTTCTGGACGGGCTGGCCGAGCTGCG
CGGGATCCTTGTGCAGGGAAGAGCTGCCCTGGGCACCTGGCACCACAAGACCATGTTTTCTAAGAACCAT
TTTGTTCACTGATACAAAAAAAAAAAAAGGAATTCATGATGCTGTACAGAATTTTATTTTTAAACTGTCT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001001576.1
Summary The protein encoded by this gene catalyzes the hydrolysis of cAMP and cGMP to their corresponding monophosphates. The encoded protein plays a role in signal transduction by regulating the intracellular concentration of these cyclic nucleotides. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 5152

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.