PDE9A (NM_002606) Human 3' UTR Clone

CAT#: SC203230

3`UTR clone of phosphodiesterase 9A (PDE9A) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PDE9A
• Synonyms: HSPDE9A2
• ACCN: NM_002606
• Insert Size: 210
• Sequence Data:
  Insert Sequence

  >SC203230 3'UTR clone of NM_002606
  The sequence shown below is from the reference sequence of NM_002606. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGTGAAGGAGACTGTGCCTGAGGAAAGCGGGGGGCGTGGCTGCAGTTCTGGACGGGCTGGCCGAGCTGCG
  CGGGATCCTTGTGCAGGGAAGAGCTGCCCTGGGCACCTGGCACCACAAGACCATGTTTTCTAAGAACCAT
  TTTGTTCACTGATACAAAAAAAAAAAAAGGAATTCATGATGCTGTACAGAATTTTATTTTTAAACTGTCT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_002606.2
• Summary: The protein encoded by this gene catalyzes the hydrolysis of cAMP and cGMP to their corresponding monophosphates. The encoded protein plays a role in signal transduction by regulating the intracellular concentration of these cyclic nucleotides. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
• Locus ID: 5152