NSDHL (NM_015922) Human 3' UTR Clone

CAT#: SC203332

3`UTR clone of NAD(P) dependent steroid dehydrogenase-like (NSDHL) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "NSDHL"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol NSDHL
Synonyms H105E3; SDR31E1; XAP104
ACCN NM_015922
Insert Size 265
Sequence Data
>SC203332 3'UTR clone of NM_015922
The sequence shown below is from the reference sequence of NM_015922. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TGGAGAGGACCGTGCAGAGCTTTCGCCACCTGCGGAGGGTCAAGTGAGGGACACTGGAGGCTGGGCTCTC
TCGACACGTTGCTCAGCCAGTCACTCCTTCCCCTGTGGATTGATGAAATAACATCCTTTGAATGAGTTTG
CTCTGAGCCTGTGACTCCTTCTGCTAGGCAGAGAGCGCACCCTACTCTTTCCGTGACGATGAGGGCGGCA
AAAACAGACATTTCTTCCTTCATGGAACTGGATTTGGATTTCTTGAAGCAGGCAG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_015922.2
Summary The protein encoded by this gene is localized in the endoplasmic reticulum and is involved in cholesterol biosynthesis. Mutations in this gene are associated with CHILD syndrome, which is a X-linked dominant disorder of lipid metabolism with disturbed cholesterol biosynthesis, and typically lethal in males. Alternatively spliced transcript variants with differing 5' UTR have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 50814

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.