ABCA6 (NM_080284) Human 3' UTR Clone

CAT#: SC203363

3`UTR clone of ATP-binding cassette sub-family A (ABC1) member 6 (ABCA6) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ABCA6
• Synonyms: EST155051
• ACCN: NM_080284
• Insert Size: 278
• Sequence Data:
  Insert Sequence

  >SC203363 3'UTR clone of NM_080284
  The sequence shown below is from the reference sequence of NM_080284. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGAAACTCCTCCCTCATTCAGATGAACCTTAAAACCTCAAACCTAGTAATTTTTTGTTGATCTCCTATAA
  ACTCATGTTTTATGTAATAATTAATAGTATGTTTAATTTTAAAGATCATTTAAAATTAACATCAGGTATA
  TTTTGTAAATTTAGTTAACAAATACATAAATTTTAAAATTATTCTTCCTCTCAAACATAGGGGTGATAGC
  AAACCTGTGATAAAGGCAATACAAAATATTAGTAAAGTCACCCAAAGAGTCAGGCACTGGGTATTGTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_080284.2
• Summary: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This gene is clustered among 4 other ABC1 family members on 17q24 and may play a role in macrophage lipid homeostasis. [provided by RefSeq, Jul 2008]
• Locus ID: 23460